Jump to content
Evolution Fairytale Forum

xbox

Member
  • Content Count

    48
  • Joined

  • Last visited

Community Reputation

0 Neutral

About xbox

  • Rank
    Junior Member

Profile Information

  • Gender
    Male

Previous Fields

  • What is your Gender?
    Male
  • How old are you?
    43
  • What is your affiliation/religion?
    no affiliation
  • What is your Worldview?
    Atheist
  • Where do you live (i.e. Denver, Colorado)
    Northfeild, Vermont
  1. Yes, of course - IF you can show something to be true, one would have to accept it or be shown to be a fool (or worse). No, it is a metaphorical code. Your depiction of it is a metaphorical description - it is how we describe it to make it understandable. If one looks into the details of genetics, one sees so many deviations from the 'rules' of 'codes' that to call it a code can only be for simplicity. WE append the concept of "meaning" to what goes on - there is nothing inherent in DNA or biochemistry that makes molecular interactions 'meaningful.' But if you did not know about Morse code, would you be able to know what it means? Or that it even is a code? Defining what a code is is fine, but then extrapolating that to the interactions of DNA and RNA and such is question begging - you are asking, in this case me, to accept that which has not been demonstrated. Well, lets examine the evidence and see. However, I must say that I agree only for the purposes of discussion. IF all of the evidence could be either for creation or natural processes, then we have to have a way, a criterion, to differentiate. What do you propose? ONLY from human intelligence, yes. Thus, the ONLY logical inference you could make, providing your premises are correct, is that humans created DNA. Ambiguating (is that a word?) human intelligence by referring to it as "intelligence" does not change the facts. ALL 'codes' that we know of are human inventions. We do NOT have anything like 100% inference re: genetic code coming from an intelligence. At best, what you have is an argument via analogy. Analogies are not evidence. OK, fair enough. It is good to see that you are acknowledging that this is 'in your view' as opposed to presenting this as an objective factual position.
  2. Correct. False, trivially so. Evolution need not be an assumption at all. Mutations happen, some get passed on to offspring, the patterns of unique shared mutations passed from parent to offspring are indicative of a parent-offspring relationship. That is a simple, observable, empirically proven fact. That this simple fact can be and has been extrapolated to test evolutionary hypotheses is irrelevant as to the foundational basis. Paternity testing, shown to be more than 99% accurate, is premised on the very foundation I just described. Strawman based on a falsehood. The alignments are arranged the way they are because it is the only reasonable, logical thing to do. Partental sequence: GTAAGCCTGTGTGAAAAACCCGTGACTGAC Offspring sequenbce: TAAGCCTGTGTGAAAAACCCGTGACTGAC Alignment performed by informed geneticists: GTAAGCCTGTGTGAAAAACCCGTGACTGAC _TAAGCCTGTGTGAAAAACCCGTGACTGAC Alignment performed by one seeking to undermine rational scientific practice: GTAAGCCTGTGTGAAAAACCCGTGACTGAC TAAGCCTGTGTGAAAAACCCGTGACTGAC One of those alignments makes sense. One does not. Strawman. The patterns of unique, shared changes are the evidence for the very simple and empirically proven reasons I mentioned above (and have provided citations and abstracts/quotes for in this very thread and others).
  3. If it is true, yes, obviously. Demonstrating it to be true will take some doing however. Of course, what we call the genetic code is really an observation of the physical-chemical interactions of molecules. We call it a code metaphorically. No proof for any negative argument exists. Do you have 100%objective proof that God DID create the genetic code and DNA TO create life? What if God created it for some other purpose, and life was a byproduct? Establishing a definition in this way is simply creating a no-lose scenario for your argument, it is illogical. Each of your examples is a code only to those who understand to be such – a Bantu tribesman who has never been exposed to English will have no idea what English or morse code is, and would not identify it as such. And under your ‘definition’, i.e., “Note that ALL evidence, either for "naturalism" or "creationism" is in a POTENTIAL state, until the objective proof is in, as to which "suspect" is responsible,†ALL OF NATURE is evidence for naturalistic processes. Does not follow. Not having evidence that the moon is made of green cheese does not prove that it is really made of blue cheese. It is question begging when, on the one hand, you claim that all the evidence could be for either creation or evolution, then follow that up with an assertion that all of creation is evidence for God.
  4. No need to put words in your mouth – your attitude and responses thus far certainly imply it. Why would I accept something so patently absurd? You can – and likely will – continue to ignore my explanations and such, but that will be your loss. What you wrote is precisely akin to demanding that NASA physicists re-prove gravity and Newton’s laws every time they launch a rocket. It is not ‘too hard’ – it is simply absurd on the face of it. “"Yes there are mutation events that cause deletions, I do not doubt that... What I do doubt, (and I'll bold this for you), is that every single space in alignment actually was from a deletion mutation, how can they be sure? How can they support their claims for each and every one? It is unfalsifiable, (and thus isn't empirical)."†You accept that mutations – to include deletions – occur, yet you want to know what ‘proof’ there is that every gap in an alignment is a deletion? At worst, it is an extrapolation from known events (such as the papers I cited and explained to your earlier that you dismissed). Misrepresentation. I said nothing about the size of the task; nor is alignment generation guesswork. Misrepresentation. No need for me to put words in your mouth on this – I directly quoted you on it. Shall I do it again to let everyone know what is going on? OK: “Everytime a deletion is assumed via alignment it is assuming frameshift events... (Since the deletion of 1 or 2 bp results in a frameshift) This is one of the points I was trying to get across “ And another: “Furthermore, lets give the evo's the benefit of the doubt and agree that all the spaces made were from deletions... Then that would be implying many thousands of frameshift events, that (somehow) didn't lead to the organism's death. I find both of these assumptions troubling since they are indicative of how unscientific "science" can be. “ You do not seem to grasp the fact that frameshift mutations ONLY affect genes, and that genes only make up about 2% of the genome. Your whole argument is premised on a fallacy. I find the notion that you are unfamiliar with the way in which genomes are organized and the basics of genetics yet feel comfortable arguing against a means of analyzing genetic data disturbing. And more indications of your unfamiliarity with science in general. ALL science employs assumptions. That is how things get done. You ASSUME that the work done prior to yours has been vetted properly and as accurate as it can be, you then use that – you assume – to move on. You want to denigrate and minimize work that you have admitted by your word choices and assertions not to understand very well in order to … what? I don’t want to speculate for I will be accused of something. You keep saying that I delete things from my earlier replies, yet when I look back at my posts I see each and every word you write quoted. http://www.evolutionfairytale.com/forum/index.php?showtopic=4677&st=20&p=76356entry76356'>Do you not think others can see that, too? How could I have deleted and not responded to this when I did NOT delete it and DID respond to it, as a rational person can by looking at http://www.evolutionfairytale.com/forum/index.php?showtopic=4677&st=20&p=76356entry76356'> the actual post. A red herring? I’m putting words in your mouth? So tell me please – was it ME that wrote this: “hence you cannot just add allignments in where-ever you please as they now have consequence since for each allignment assumed it is assuming that a mutation occured, thus impacting on the function of the "junk" DNA.†I see the word “FUNCTION†in there, don’t you? I also see an argument against putting gaps (“add allignments’ [sic]) in alignments because this would impact the “function of the “junk†DNA†(still waiting for evidence that all junkDNA is functional). Your focus on pedantics and semantics says much. I am not confused, nor am I making unwarranted assertions. I am trying to discuss issues that you brought up – tangentially, perhaps, but they are relevant to the overall issue nonetheless. No, I need to bow out so as not to give anyone sufficient ‘banning fodder.’ I note that not once did you address the simplified examples I provided or explain why you thought they were not relevant. I suspect you are a believer of the old adage that the best defense is a good offense – in this case, hurling untoward accusations and refusing to reply to questions is your defense. That is the way it goes. You would understand the folly of this position if you had taken the time to merely peer at the simplified sequences I provided to you. I’m done here.
  5. That is a Science Daily news blurb. It is about a specific type of noncoding DNA. That type of noncoding DNA is not ALL noncoding DNA. News releases, even on Science Daily, unfortunately, are often hyperbolic and sensationalized. RE: ENCODE - Amazingly astute – in fact, that is why I mentioned it as I did. I realize that I demonstrated that not all ‘junkDNA’ has a ‘purpose’ and the like. What was your purpose in mentioning that Science Daily article? Were you drawing a long bow? It is not, after all, my position that all noncoding DNA is junk. It is that much of it is. It seems to be the YEC/IDC position that all noncoding DNA is functional. Is that your position? OH – yes it is: “You do realise that its been a few years since we have found that ALL DNA has a purpose.†Still waiting for you to produce evidence of this. No? Then who wrote this: “Everytime a deletion is assumed via alignment it is assuming frameshift events... (Since the deletion of 1 or 2 bp results in a frameshift) This is one of the points I was trying to get across “ Let me guess – I am somehow misrepresenting you, right? Say we have these two sequences: ATTGTCTGTGGTGTCCCAAA ATTGTGTGGTGTCCCAAA We want to align them, and can do this: ATTGTCTGTGGTGTCCCAAA ATTGT__GTGGTGTCCCAAA We could also do this: ATTGTCTGTGGTGTCCCAAA ATTGTGT__GGTGTCCCAAA In which case does the “positioning of blanks†make more sense to you? I look forward ot seeing you ignore/dismiss this – not that I intend to reply…. I was not questioning whether or not you accept that mutations occur. If that is what you gleaned from what I wrote, then I suggest that YOU read what I wrote two or three times and see if it sinks in. Then I suggest you read the papers I referred to, and then re-read three times what I wrote in addition to providing the links. Here is a hint – I did not present them to “prove†that mutations occurred. If you had read what I wrote, you would understand this: “This is pretty much "observed" insertions/deletions/substitutions under controlled lab conditions, i.e., empirical.†From the empirical data – data produced by mutation – alignments were made and trees generated. The researchers knew the “original’ sequence, then when they aligned it against the ‘new’ sequences, they could see where the changes were. Justified. You think so? Really? You do not think that NASA physicists ASSUME that gravity acts the same way around Jupiter as it does here when they plot spacecraft trajectories? Who said they did? Sorry, this is simply false. See my explanation above. If we have this sequence in a parental organism: ATGGTGTCCTAAATG And this one in an offspring: AGGTGTCCTAAATG Do you really think assigning a dash here to compare them: A-GGTGTCCTAAATG is ‘willy-nilly? Are you still claiming, as you did earlier, that ALL ‘junk DNA’ is NOT junk? If that Science Daily article was your justification for that erroneous claim, then I suggest you do some more reading on the matter, and start with the basics, like first finding out what a transposon is. Do you assume that the earth will be rotating tomorrow as it is today? Especially when you misrepresent it in such a way. I did not re-iterate the problem, I explained why it is not a problem. Your response was to mischaracterize it as a reiteration. That allowed you to avoid dealing with it in a rational way. http://www.evolutionfairytale.com/forum/index.php?showtopic=4677&view=findpost&p=76240'>Here is my initial claim for reference. Which is why I explained why it is not a problem. You ignoring my explanation does not mean none was given. The only whimsical opinion I see being espoused is the one that alignment algorithms are ‘cheating’. When I provided a simplified example of my explanation, you simply dismissed it, then reiterated your whimsical ‘problem’ – how can they be sure that the gaps are the result of deletion events? Forgetting, I guess, that insertions also occur. Which is odd, since the Science Daily piece you linked to referred to insertion events. Had you taken the time to actually look at my simplified example and questions, you might have been in a better position. False. You did not even attempt to address the question. Why is that? Yes, really. How else to interpret your reluctance to even attempt to address the examples and questions I provided? Regarding your root problem – what is it you think is happening? You think that the aligned sequences were ‘created’ that way and that so-called gaps are not gaps at all? What is your empirical evidence for THAT? You are right – in fact, your children’s chromosome 1 probably differs from yours by dozens or more mutations. How then to compare them? If the first nucleotides in your chromosomes don’t line up, are your chromosomes 0% identical? The reason you will not even address this – and in fact make absurd excuses not to – is obvious.
  6. xbox

    Trees Of Life

    This: "Firstly even if "many / most analyses" produce congruent trees, it has no bearing on the FACT that use of different sequences may give differing results..." does not come across as an "admission." But it is good that you have explicitly admitted your error. It is NOT semantics when on the one hand you say “will†and another you say “may.†Apparently, you do not realize that those words have very different meanings. You say you “corrected†the statement before I replied, then I produce the original quote which remains as I quoted it. Thus, you did NOT ‘correct it’ at all. If you mean you saw the error of your ways later and changed your mind, that is one thing, but to claim that you ‘corrected’ it in the quote I referred to is hogwash. No, it just demonstrates that you were giving conflicting statements, which is why I brought it up in the first place. Can you not see that I directly quoted your own OP? And that I replied directly to that quote in a previous post? Do you not even recall WHY you wrote what you quoted above? Shall I remind you? Maybe write it in bold? gilbo12345, on 01 November 2011 - 09:23 PM, said: "What are the practical uses of creating a "tree of life" and the endless studies done to attempt to verify the tree or change it somewhat? (since each set of results or gene sequences will give different trees, thus nothing can be claimed exactly for certain)." xbox: That is not true at all. Many/most analyses produce congruent trees. It all depends on which taxa are used - not all studies use the same ones. It was only then that you changed “will†to “mayâ€ÂÂ. Which is why I re-quoted your original erroneous proclamation and asked why you had written it. My initial response in this thread was to correct your false claim about trees in your OP. YOU then kept adding material to your replies. I just kept making the mistake of responding, which I will try not to do in the future. Correcting erroneous claims should always be done. You said "may" after I corrected your false claim, but you originally said “willâ€ÂÂ, which is why I quoted it. I was wondering why you were changing your tune, for you did not even ask me for justification (which implies to me that you knew your OP's claim re: trees was incorrect). Rather than admit error or admit outright that you had changed your mind, you tried to accuse me of “misrepresentationâ€ÂÂ. This is getting to be absurd. Your method of ‘point by point’ ends up making you miss lots of subtleties which I think leads you to make these silly false accusations. Keep doing it if you want. There are differences, then there are differences. Having analyses give conflicting results on whether Wollemia is more closely related to one species or another is substantively different than a study grouping Wollemia with a fish. Just mentioning ‘differences’ makes no distinction between the two and so is misleading. What question am I begging, exactly? I am not asking you to admit that which you disagree with, I am pointing out a subtle misleading use of terminology. Since cancer treatments are not 100% effective, are they just "whimsical" and not reality based either? It is easy to search the literature to find lab experiments producing known phylogenies and then using the methods you claim produce “whimsical†non reality-based outcomes reproduce the known phylogenies. It is easy to read a textbook and see that different parts of genomes mutate at different rates, that taxon sampling and heterozygosity can affect analyses, etc. You seem to want everything to be a neat, tidy little bundle with 100% accuracy and reliability. There is NO field of science or applied science (such as engineering) than can do this. What field of science are you aware of that IS 'definitive'? It is not whimsical at all. Your self-correction without qualification or admission after I merely pointed out your error you mean? Asking questions is not “misrepresentation†– because after all, I ASKED why you had originally written “willâ€ÂÂ. You are implying - even after you allowed that they can be used for some things - that because trees do not always match 100% that they (and thus the field) are useless. Did you write those words exactly? No - it is my impression (to avoid future spurious accusations). I then asked if this criterion - 100% reliability and accuracy - is applied to other field or just this one. False accusation. Not only did I quote it completely, I replied to it in the very post you are replying to here. In fact, you reply to what I had written below. I suggest that BEFORE you hit the reply button and write up a response that you actually read through the post you are responding to to avoid making these false accusations in the future. I replied to that very bolded quote. In fact, I QUOTED it. That my response was not what you wanted to see does not constitute a dismissal of it. T You want me to write “No†so you can gloat and hurl more accusations. The fact is, I replied in some detail to that ‘question’, and I note that YOU did not reply to it at all: That is why I asked what your point is. You seem to think that such studies are worthless. Your OP asks if there is any need for these studies. You imply that they do not directly benefit humanity, and thus are worthless. They are not worthless from an evolutionary perspective. The methodology employed in these studies has been used to predict which strains of influenza will be prevalent in upcoming years. Phylogenetic analyses have helped uncover the mechanisms behind thalassemias and sickle cell disease. And yet phylogenetic trees are produced to test evolutionary hypotheses (in part). Without evolution would there even be such things? This is a discussion forum to discuss evolution, right? You are anti-evolution, right? How is it a misrepresentation to try to get to the gist of your thread theme? How is asking a question misrepresentation? In real life, I quoted EVERYTHING you wrote. Maybe you should read my actual reply again (for the first time?) and you will see that, in fact, I quoted every word you wrote AND replied to everything. Me too. Which is why I think I will choose others to discuss things with from now on.
  7. How do YOU define 'macroevolution'?
  8. xbox

    Trees Of Life

    I can do without this sort of condescension, especially when, as I will prove, it is unwarranted and false. HOW could I be misrepresenting you when I QUOTED you? You said you edited what you wrote before I replied, but I COPIED AND PASTED what YOU wrote! This is just incredible. In fact, what I quoted STILL EXISTS AS I QUOTED YOU, thus to claim that you edited it before I quoted it is simply false. It is from YOUR OPENING POST for crying out loud: “(since each set of results or gene sequences will give different trees, thus nothing can be claimed exactly for certain).†There it is, word for word. Just as I quoted it. THAT is what I quoted – you, in fact, misrepresented ME when you claimed I quoted something else. Here is the actual exchange: It is true that you MAY get incongruent results depending on which loci you use. It is also true that there are reasons why that is so. But it is also a fact that you wrote: "...since each set of results or gene sequences will give different trees" That statement very clearly means that every time a different locus is used, the phylogenetic tree produced will be different. That is simply not true. One can easily see that I directly and accurately quoted your statement “Firstly even if "many / most analyses" produce congruent trees, it has no bearing on the FACT that use of different sequences may give differing results,â€ÂÂ, in fact, I italicized your word “may†for emphasis! If you had changed your tune, you could have simply said so instead of accusing me of misrepresentation. Please do not attempt to ‘win’ via false accusations again. It may be helpful if you replied point-by-point – it may be easier for you to keep track of things. In fact, I am going to convert the rest of your response to a point-by-point exchange in the hopes that it will help you. 2. What I am getting at is that the results gained from a small % of the DNA may not be consistent with the rest of the DNA or with other parts of it. Hence it is assumed to conform, this is the main thrust of what I am attempting to claim here. So you admit to there being differences.... Thanks for proving my point. What do you presume those differences are? And are mere differences alone enough to justify a rejection of the entire field? Shall we apply that criterion to things you take for granted as well? I have a feeling that you would not accept that. 3. And? I meant relative to the rest of the DNA not in general. There would be cases whereby the mutation rate over the chromosome would differ, and whilst some areas may give a reading it may not be a true indicator of the whole.And? This is why multiple loci or very long continuous loci are used when possible. 4. And?And what? The use of multiple loci or very long loci tend to “smooth out†the bumps. 5. Did I say "ALL" loci will give different outcomes. That is why I asked you, but you certainly said so in your OP, and you seem to be implying it all along. No answer? 6. Did I say that it makes the source invalid? (YOUR WORDS, not mine) You’ve been implying it all along. Again, does that criterion extend to other areas of inquiry, or just this one? 7. Again more misrepresentation... Again more unwarranted accusations. I am asking what your point is, in effect. If you do NOT think that these incongruencies somehow damage ‘evolution’, why did you bring it up? That is why I asked what your point is. You seem to think that such studies are worthless. Your OP asks if there is any need for these studies. You imply that they do not directly benefit humanity, and thus are worthless. They are not worthless from an evolutionary perspective. The methodology employed in these studies has been used to predict which strains of influenza will be prevalent in upcoming years. Phylogenetic analyses have helped uncover the mechanisms behind thalassemias and sickle cell disease.
  9. I don't believe that I referred to any study that indicated that 99.9% of any genome is useless. Can you point out which one it was? The amoeba was a means to an end. I have explained two or three times already that there are any number of organisms I could have referred to. It does.Evidence please. How would the amoeba do this? Why do you think an increase in a few seconds in DNA replication would matter? I do not see how. You seem to be assuming that if evolution does not operate in the caricature-like manner you seem to think it should, then you are safe to conclude that it is false/in trouble. You seem to think that evolution MUST seek maximum efficiency via a pure selection-driven process. Selection is but one of many phenomena that drive evolution. Repeating an unsupported assertion does not give the assertion more weight, sorry. So you say. Still waiting for evidence. Then why do the alleles associated with sickle cell not get selected against? I'm still waiting for the explanation as to why a few seconds in DNA replication time would be that much of a selective issue. I am suggesting that proposing that some cells use the 'excess' DNA in nuclear formation does not mean that all do, and that positing that because some do that all DNA 'has a purpose' is at best unwarranted. I am suggesting that its massive genome is an issue for those claiming that ALL DNA is functional and indicative of CSI which is indicative of Design. And that seems to have been borne out. Sure, on average. But averages do not equate to all, and this still does not address the issue of CSI. The fact that you seem to be focusing solely on Polychaos when I have made it clear that there are any number of organisms I could have used. If you are looking for capitulation on Polychaos, fine, but that will not have resulted in an answer to the CSI problem. I could have used lungfish, salamanders, etc. On average, right? What about those that are not 'average' (which is an awful lot of them)? So you say, but you have not provided any real scientific rationale why. Nor have you explained why YOUR version of how to calculate CSI is better or more correct than the chap on CARM's. Perhaps. Noncoding. I've done many many alignments of noncoding DNA across dozens of species at many loci, and even within species, I have seen tremendous amounts of variation in stretches of noncoding DNA. High school? I wish I had known that before. For a high schooler, you are very well versed in the basics. I teach immunology - it is a very interesting field. Lots of molecular biology - any plans on where you want to go? I have a student at UW now. That said, I think you would do yourself a favor not to argue points so aggressively and "confidently" - at your level, even though you clearly have spent some time on this, you are lacking some basic/foundational knowledge that can trip you up when delving into technicalities and specifics. Now, back to bashing you .
  10. How do you know what the "intended purpose" is? Knowing what it does and then extrapolating backwards is NOT a divination of 'purpose', it is post hoc equivocation.
  11. xbox

    Trees Of Life

    It is true that you MAY get incongruent results depending on which loci you use. It is also true that there are reasons why that is so. But it is also a fact that you wrote: "...since each set of results or gene sequences will give different trees" That statement very clearly means that every time a different locus is used, the phylogenetic tree produced will be different. That is simply not true. I'm not sure what that is supposed to mean. It is impractical at this time to employ full genome sequences for phylogenetic analyses - there are too few taxa whose genomes have been completely sequenced and the analysis of that much data would take a spectacularly long time. There will come a time when such analyses are practical and feasible, but that is not today. Analyses of individual or groups of genes or noncoding regions do not always produce the same results for very well documented reasons (e.g., taxon sampling errors, the use of unidentified hot spots, etc.). Of course, the differences we are talking about are generally inconsequential. You would have relativey little phylogenetic signal. I've had that happen in my studies. You get poor resution or poorly supported nodes. You can generally tell this when you look at your data matrix. A single study using a single locus? Probably not. Most studies that I am familiar with use multiple loci to avoid such issues. You WILL get differences in this particular case using the particular locus that they did. Do you think this proves that therefore ALL loci will give different outcomes? Do you think your criterion extends into other areas of inquiry as well, or just this one? That is, if when using a single general source, like a genome, analyses produce incongruent outcomes, then the use of that source is invalid? Regarding this specific example (which I knew nothing about, but leaned all that was necessary in about 5 minutes), it appears that the relationships between Araucaria, Agathis, and Wollemia are uncertain, but that all previous studies have grouped them together (i.e., there was no uncertainty that they were all closely related, the questions arose as to whether which one was more closely related to which within the group of three). This study, using 8 genes, indicates that Wollemia and Agathis are a group, which then joins Araucaria. If another study indicates that Wollemia is closer to Araucaria, will that mean that evolution is wrong? Can'tr see how.
  12. It does seem that uniformitarianism has religious roots. I came across this at the CARM forum: and Those quotes are from a creationist in Texas who claims to give anti-evolution 'deprogramming lectures' at his church. 'That their own words my refute them...'
  13. Why would it need to get rid of it? What does this have to do with CSI? I thought you said that all DNA has a purpose? "In other words, much of the amoeba's DNA serves a purpose similar to that of the packing peanut. It fills space so the nucleus is constructed at the right size." And more directly, in response to this statement from me: "You fail to see that actual point of MY argument - it is CREATIONISTS that claim that all junk DNA is 'fully functional'." YOU replied: "It is. There is no "useless" DNA, except that which has been compromised by mutations." By the way - what is your evidence that some DNA has been compromised by mutations? Why is that? There was no 'accusation', just an observation. I think that what you attempt to do next severely undermines your (and Rana's) point. So have at it! And yet, there are many exceptions, which is why it is unwise to put all of one's eggs into one basket. When a muscle hypertrophies, it does so via increasing the mass of each individual muscle cell, yet when, say, a bone gets larger, it does so by increasing the number of bone cells. There is no exact one-to-one relationship. Which is why even if the preponderance of evidence indicates a causal relationship, there will be examples - many of them - where this causal relationship does not apply. There are cells within your own body that buck this trend:These are cells from the human colon. Note the relationship between the size of the nucleus and the size of the cell as a whole. Here: Are cells from different areas of the human kidney. Please note the disparity in cell/nuclear volume size ratios. Of course the real question is then how much CSI does that DNA possess? And if it can be so dramatically altered via mutation, does the concept of CSI even apply? It is relevant because it demonstrates that YEC's claiming "expertise" in these areas cannot seem to stay on the same page (except in terms of their all-purpose escape clauses). It is not my fault that YECs and IDCs cannot get their collective acts together. It is not my fault that you (collectively) seem to want to have your cake and eat it too, then deny that cake matters when you find it is not palatable. You want to claim that creationism/ID is "scientific", yet when the brass tacks are down, you want to hide behind Scripture, thus tearing down the facade. 1. There is more to evolution than selection. 2. Due to linkage issues, genes that are not "under selection" can be selected for (or against). 3. 'Function' is a slippery word, isn't it? You mean like the tuna's? Or is it ours? Why would there have to be selection on 'half' a gene? And? How does that equate to specificity? You appear to be referring to a one-shot all by pure chance formation of 'the' cytochrome C gene. Are you not? How do you know that is its sole specification? Because one would be the act of a human-like intelligence, for only humans are known to employ applied mathematics; the other is not. Yes, but we should also understand that anthropomorphic analogies are not evidence and can only go so far. I submit that you are the victim of a disinformation campaign. Evolutionists have never said such a thing, in fact, evolutionists were researching and predicitng and speculating about function in noncoding DNA for DECADES before the term "junk DNA" was even coined (and even then it only referred to a specific type of noncoding DNA). Google "Genomicron junk DNA" to find many many citations and quotes going back decades documenting the true facts about what evolutionists thought about 'junk DNA'. Got to run... Oops - just saw this: And the above one is ad hominim. Your point? I suggest you learn what an "ad hominem" argument is before you so cavalierly make such accusations: Description of Ad Hominem Translated from Latin to English, "Ad Hominem" means "against the man" or "against the person." An Ad Hominem is a general category of fallacies in which a claim or argument is rejected on the basis of some irrelevant fact about the author of or the person presenting the claim or argument. Typically, this fallacy involves two steps. First, an attack against the character of person making the claim, her circumstances, or her actions is made (or the character, circumstances, or actions of the person reporting the claim). Second, this attack is taken to be evidence against the claim or argument the person in question is making (or presenting). This type of "argument" has the following form: Person A makes claim X. Person B makes an attack on person A. Therefore A's claim is false. ad hoc  [ad hok; Lat. ahd hohk] Show IPA adverb 1.for the special purpose or end presently under consideration: a committee formed ad hoc to deal with the issue. Please do not go down the false accusation road.
  14. I have no idea what that is even supposed to refer to. Sorry.
  15. How isn't it? Never mind - I forgot that there is the whole "soul" escape clause. Of course, deferring to the presence of the soul to wriggle out from under the CSI conundrum sort of takes the wind out of the "intelligent design is science" sail, doesn't it? Really? which proteins, do you think? Chrloroplasts make their own proteins, not sure why the nuclear genome would need to be bigger. Perhaps you can explain your rationale? So, CSI is irrelevant? It sure sounds that way. I'm not really sure why that matters, but harping on it does distract from the main points. Every design is a trade off. Even for the Creator of the universe? You are putting limitations on Him to support a fallible human argument? Why not large and virile? Yours is an ad hoc argument.
×

Important Information

Our Terms